Data Conversion

Nanosphere, Inc. Q2 2008 Earnings Call Transcript Seeking Alpha, NY - 6 hours ago

Does anybody know where I could find a time comparison between an operating system backup and an RMAN backup? Thanks.

This is an excerpt from the latest version perlfaq4.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

Sorry to post this here, but I only posted this here so ignore if you don't know. This if very OT for a Perl group. I'm one of those people who used to enter contest's and mail my code in for evaluation. I had different code programs mailed into different people. Back then I didn't really know better.

Conversion Services International Provides Notice to Move its ... IT Business Net, CA - 2 hours ago

This is an excerpt from the latest version perlfaq4.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

Outline Before posting to comp.lang.perl.misc Must - Check the Perl Frequently Asked Questions (FAQ) - Check the other standard Perl docs (*.pod) Really Really Should - Lurk for a while before posting - Search a Usenet archive If You Like - Check Other Resources

This week my tutorial is on PHASE 1 of the

My Pet Peeve of the Week is

Secure Bytes audit and vulnerability assessment software Secure Auditor named “Versatile tool” and earn “Five Star Ratings” in SC Magazine Group Test Secure Bytes is really pleased to share this great news with its associates that Secure Auditor has been branded as a Five Star product by SC Magazine August 2008 edition. SC Magazine is among the world’s

Hello, I'm a newbie in Perl and do some work in Bioinformatics. I write a tiny script to show the sequences. However, I have a problem while I'm going to further process. My output looks like this. IGRRQWASLVTPMAKFDPEIVLEFYANAWP TEEGVRDMRSWVRGQWIPFDADA IGQLLGYPLVLEEGQECEYGQRRNRSDGFD EEA gaggccatcaagggatggtcgtttctccgg gagcaacgcgtccagctcagggacgacgag

This is an excerpt from the latest version perlfaq5.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

I have a CGI script that allows users to upload image files to a website. I limit the file size to 75K. The problem is if someone tries to upload a file larger than 75K, and the user clicks Submit, the script basically just resets itself with no warning; none of the functions get triggered. Can someone tell me how to capture that "event" when a file size is

Hi, We are configuring RMAN. We are going to include the archive logs as part of the backup set. Once backed up, I assume we do not need those logs on disk anymore. According to the documentation, if you use the option DELETE ALL INPUT, it will delete ALL the archive logs. But it says if you use DELETE INPUT, it only delete the logs it backed up.

Have any one familiar with Perl Dev Kit? I want to compile my game.pl script to executable. So I can run this command "game" anywhere on command windows. Maybe set some environment variable? Any help> Currently, I have to run where game where it is located with such as in the C drive otherwise I get this error.

This is an excerpt from the latest version perlfaq6.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

Hi, all. Running 9i (don't have a version number) on Solaris. A stored procedure is calling an external C library. I'm looking to confirm whether or not this C library is being held in memory after it's called. The user is theorizing that it is not, and that it's being retrieved from disk each time it's called.