Data Conversion

Although not a big deal, and absolutely meaningless technically, up until now, DB2's name has managed to stay operating system free. However, with Version its name gets a little longer. On November 30, 1995 DB2 for MVS/ESA Version 4 went generally available (GA). From this point forward DB2 will no longer simply be DB2. New features/functions delivered by DB2 V3 were:

• Stored procedures

This is an excerpt from the latest version perlfaq4.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

From the Delhi desk: A few months back, I postulated that a useful way to characterize a PPM environment was to use a 2x2 quadrant. Now that I have had a few months to employ this thinking tool, I now believe that this is the most useful way to describe and understand the state of a PPM organization. To recap, the four-box quadrant looks like this: X1 Y1: Decentralized / Non Standard X1

Hearst-Argyle Television, Inc. Q1 2008 Earnings Call Transcript Seeking Alpha, NY - 13 hours ago

This is an excerpt from the latest version perlfaq4.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

This week my essay is entitled,

My Pet Peeve of the Week is

Hi all, i've a problem with the 10g SQL*Loader running on z/OS. If i try to load an dataset which is VB stored the loader produced an "Abend S0C4". The same dataset will be loaded with the 9.2 loader, there are no problems. If i copy the dataset to an other dataset which is FB stored it will load without errors.

Thomson - Major Orders, Industry Awards, New Products At NAB 2008 broadcastbuyer.tv (press release), UK - 23 hours ago

Okay, I surrender! I've received bunches of emails as well as personal messages here asking when I'd get back to blogging here.

I am currently doing some work for a client that is all to do with making ITIL work. Its great I get to pay the bills and I have a pretty smooth job, no day to day hassles with troublesome systems.

I think playing the Brain Drain Game causes me Brain Drain Pain. How about you? Are you experiencing Brain Drain Pain?

Review: Roxio MyDVD 10 Premier VNUNet.com, UK - 20 hours ago

LewisC's An Expert's Guide To Oracle Technology I think the concept of cloud computing and cloud storage has been bandied about long enough that most people get it and they get the business case. I'm not sure people get the use for databases in the cloud. If you are completely unfamiliar with the term "cloud computing", check

I am using (roughly) the following code. my %counter = () ; $counter{label11}{parent} = 'label1' ; $counter{label11}{hits} = 14 ; $counter{label12}{parent} = 'label1' ; $counter{label12}{hits} = 14 ; If I use: for my $key(keys %counter), I get label11 and label12 as values. I would like to run something like: foreach my $key(keys %

Markzware Announces The Update Of FlightCheck v6.11 WebWire (press release), GA - 5 hours ago

This is an excerpt from the latest version perlfaq3.pod, which comes with the standard Perl distribution. These postings aim to reduce the number of repeated questions as well as allow the community to review and update the answers. The latest version of the complete perlfaq is at [link] .

Here is a blog post linking to a recent podcasting interview I did with Jon Mell, from Trovus, detailing some more on my experiment of giving up on e-mail, i.e. work related e-mail. It lasts for about 35 minutes, and in this entry you will be able to read some more as to what you would expect from such a lovely conversation I had with Jon.

Hello, There's a problem while I'm processing sequences. My file content. ATGCCCTGACGTAAACGTAGGCTACG GCATGCCCTACGGGTACCCCAGTA And I hope I can reverse the sequences to be this. GCATCGGATGCAAATGCAGTCCCGTA ATGACCCCATGGGCATCCCGTACG I use "reverse" to do this, but it dose not work any more. So could you tell me how to solve this problem?

OTCPicks.com Daily Market Movers Digest Midday Report TransWorldNews (press release), GA - 14 hours ago